Review



brie lenticrisprv2 mouse genome-wide library  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Addgene inc brie lenticrisprv2 mouse genome-wide library
    Brie Lenticrisprv2 Mouse Genome Wide Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/brie+in+lenticrisprv2/lenticrisprv2/pm37286821-127-4-17
    Average 90 stars, based on 1 article reviews
    brie lenticrisprv2 mouse genome-wide library - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Chronic calcium signaling in IgE + B cells limits plasma cell differentiation and survival.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER P7_A02: CAAGCAGAAGACGGCATACGAGA TGCTGGATTGTGACTGGAGTTCAG ACGTGTGCTCTTCCGATCTTCTAC TATTCTTTCCCCTGCACTGT Broad Institute Protocols https://portals.broadinstitute.org/gpp/public/ P7_A03: CAAGCAGAAGACGGCATACGAGA TTAACTCGGGTGACTGGAGTTCA GACGTGTGCTCTTCCGATCTTCTA CTATTCTTTCCCCTGCACTGT Broad Institute Protocols https://portals.broadinstitute.org/gpp/public/ P7_A04: CAAGCAGAAGACGGCATACGAG ATTAACAGTTGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTTC TACTATTCTTTCCCCTGCACTGT Broad Institute Protocols https://portals.broadinstitute.org/gpp/public/ P7_A05: CAAGCAGAAGACGGCATACGAG ATATACTCAAGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTTC TACTATTCTTTCCCCTGCACTGT Broad Institute Protocols https://portals.broadinstitute.org/gpp/public/ P7_A06: CAAGCAGAAGACGGCATACGAG ATGCTGAGAAGTGACTGGAGTT CAGACGTGTGCTCTTCCGATCTT CTACTATTCTTTCCCCTGCACTGT Broad Institute Protocols https://portals.broadinstitute.org/gpp/public/ LentiGuide_PCR1_fwd: CCCGAGGGGACCCAGAGAG (Chen et al., 2015) N/A LentiGuide_Cherry_PCR1_rev: CTTGGAGCCGTACATGAACTGAGG This paper N/A Library_gibson_fwd: GGCTTTATATATCTTGTGGAAAGG ACGAAACACCG (Wang et al., 2016) N/A Library_gibson_rev: CTAGCCTTATTTTAACTTGCTATTT CTAGCTCTAAAAC (Wang et al., 2016) N/A Irf4_g1_Amplicon _fwd: TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAGGGTTCATAACTACA TGATGCCAC This paper N/A Irf4_g1_Amplicon _rev: GTCTCGTGGGCTCGGAGATGTGTA TAAGAGACAGAGCTTCATATGATG TGTCTCTGG This paper N/A Irf4_g2_Amplicon _fwd: TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAGCCGACAGTGGTTGA TCGAC This paper N/A Irf4_g2_Amplicon _rev: GTCTCGTGGGCTCGGAGATGTGT ATAAGAGACAGGCTCTGGCCTCC TCCTTG This paper N/A Prdm1_g1_Amplicon _fwd: TCGTCGGCAGCGTCAGATGTGTA TAAGAGACAGCATTCCTTCTTAC AATGCTCAC This paper N/A (Continued on next page) e5 Immunity 54, 2756–2771.e1–e10, December 14, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Prdm1_g1_Amplicon _rev: GTCTCGTGGGCTCGGAGATGTGT ATAAGAGACAGGATAAGCACCTC TTTGGG This paper N/A Prdm1_g2_Amplicon _fwd: TCGTCGGCAGCGTCAGATGTGTA TAAGAGACAGGACATGGATGGC TTTCG This paper N/A Prdm1_g2_Amplicon _rev: GTCTCGTGGGCTCGGAGATGTG TATAAGAGACAGCAGGGGTGAC ACCGTGTTT This paper N/A Cd22_g1_Amplicon _fwd: TCGTCGGCAGCGTCAGATGTGT ATAAGAGACAGCAATGGACATC CAGCTTAGCT This paper N/A Cd22_g1_Amplicon _rev: GTCTCGTGGGCTCGGAGATGT GTATAAGAGACAGTGAAGAGGG ACAGTCAGTAGAGC This paper N/A Cd22_g2_Amplicon _fwd: TCGTCGGCAGCGTCAGATGTGT ATAAGAGACAGTCTGAGCTGTA CCTTTCTAAGCAAG This paper N/A Cd22_g2_Amplicon _rev: GTCTCGTGGGCTCGGAGATGT GTATAAGAGACAGCACCTTGGC TGTTTGCTC This paper N/A Recombinant DNA Plasmid Mouse sgRNA library Brie in lentiCRISPRv2 (Doench et al., 2016) RRID: Addgene_73632 Plasmid lentiGuide-Puro (Sanjana et al., 2014) RRID: Addgene_52963 Plasmid lentiGuide-Cherry This paper RRID: Addgene_170510 Plasmid Mouse sgRNA library Brie in lentiGuide-Cherry (Cherry Brie Library) This paper RRID: Addgene_170511 Plasmid pMD2.G A gift from Didier Trono RRID: Addgene_12259 Plasmid pHIT123 (Soneoka et al., 1995) N/A Plasmid psPAX2 A gift from Didier Trono RRID: Addgene_12260 Software and algorithms MAGeCK (Li et al., 2014) N/A STRING analysis (Szklarczyk et al., 2019) RRID: SCR_005223 Cutadapt (version 1.9.1) (Martin, 2011) RRID: SCR_011841 RSEM package (version 1.3.0) (Li and Dewey, 2011) RRID: SCR_013027 STAR alignment algorithm (version 2.5.2a) (Dobin et al., 2013) RRID: SCR_004463 Ensembl genome browser (assembly GRCm38, release 89) (Kersey et al., 2016) RRID: SCR_013367 DESeq2 package (version 1.12.3) (Love et al., 2014)l RRID: SCR_015687 R (version 3.3.1) (R Core team, 2015) N/A MATLAB Mathworks RRID: SCR_001622 Fiji-ImageJ (Schindelin et al., 2012) RRID: SCR_002285 (Continued on next page) Immunity 54, 2756–2771.e1–e10, December 14, 2021 e6 .. REAGENT or RESOURCE SOURCE IDENTIFIER FlowjoTM Software for Mac OS X (Version 10.7.1) BD RRID: SCR_008520 Graphpad Prism (Version 8.4.3) Graphpad Software LLC RRID: SCR_002798

    Plasmid Preparation:

    Article Title: Chronic calcium signaling in IgE + B cells limits plasma cell differentiation and survival.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER P7_A02: CAAGCAGAAGACGGCATACGAGA TGCTGGATTGTGACTGGAGTTCAG ACGTGTGCTCTTCCGATCTTCTAC TATTCTTTCCCCTGCACTGT Broad Institute Protocols https://portals.broadinstitute.org/gpp/public/ P7_A03: CAAGCAGAAGACGGCATACGAGA TTAACTCGGGTGACTGGAGTTCA GACGTGTGCTCTTCCGATCTTCTA CTATTCTTTCCCCTGCACTGT Broad Institute Protocols https://portals.broadinstitute.org/gpp/public/ P7_A04: CAAGCAGAAGACGGCATACGAG ATTAACAGTTGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTTC TACTATTCTTTCCCCTGCACTGT Broad Institute Protocols https://portals.broadinstitute.org/gpp/public/ P7_A05: CAAGCAGAAGACGGCATACGAG ATATACTCAAGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCTTC TACTATTCTTTCCCCTGCACTGT Broad Institute Protocols https://portals.broadinstitute.org/gpp/public/ P7_A06: CAAGCAGAAGACGGCATACGAG ATGCTGAGAAGTGACTGGAGTT CAGACGTGTGCTCTTCCGATCTT CTACTATTCTTTCCCCTGCACTGT Broad Institute Protocols https://portals.broadinstitute.org/gpp/public/ LentiGuide_PCR1_fwd: CCCGAGGGGACCCAGAGAG (Chen et al., 2015) N/A LentiGuide_Cherry_PCR1_rev: CTTGGAGCCGTACATGAACTGAGG This paper N/A Library_gibson_fwd: GGCTTTATATATCTTGTGGAAAGG ACGAAACACCG (Wang et al., 2016) N/A Library_gibson_rev: CTAGCCTTATTTTAACTTGCTATTT CTAGCTCTAAAAC (Wang et al., 2016) N/A Irf4_g1_Amplicon _fwd: TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAGGGTTCATAACTACA TGATGCCAC This paper N/A Irf4_g1_Amplicon _rev: GTCTCGTGGGCTCGGAGATGTGTA TAAGAGACAGAGCTTCATATGATG TGTCTCTGG This paper N/A Irf4_g2_Amplicon _fwd: TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAGCCGACAGTGGTTGA TCGAC This paper N/A Irf4_g2_Amplicon _rev: GTCTCGTGGGCTCGGAGATGTGT ATAAGAGACAGGCTCTGGCCTCC TCCTTG This paper N/A Prdm1_g1_Amplicon _fwd: TCGTCGGCAGCGTCAGATGTGTA TAAGAGACAGCATTCCTTCTTAC AATGCTCAC This paper N/A (Continued on next page) e5 Immunity 54, 2756–2771.e1–e10, December 14, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Prdm1_g1_Amplicon _rev: GTCTCGTGGGCTCGGAGATGTGT ATAAGAGACAGGATAAGCACCTC TTTGGG This paper N/A Prdm1_g2_Amplicon _fwd: TCGTCGGCAGCGTCAGATGTGTA TAAGAGACAGGACATGGATGGC TTTCG This paper N/A Prdm1_g2_Amplicon _rev: GTCTCGTGGGCTCGGAGATGTG TATAAGAGACAGCAGGGGTGAC ACCGTGTTT This paper N/A Cd22_g1_Amplicon _fwd: TCGTCGGCAGCGTCAGATGTGT ATAAGAGACAGCAATGGACATC CAGCTTAGCT This paper N/A Cd22_g1_Amplicon _rev: GTCTCGTGGGCTCGGAGATGT GTATAAGAGACAGTGAAGAGGG ACAGTCAGTAGAGC This paper N/A Cd22_g2_Amplicon _fwd: TCGTCGGCAGCGTCAGATGTGT ATAAGAGACAGTCTGAGCTGTA CCTTTCTAAGCAAG This paper N/A Cd22_g2_Amplicon _rev: GTCTCGTGGGCTCGGAGATGT GTATAAGAGACAGCACCTTGGC TGTTTGCTC This paper N/A Recombinant DNA Plasmid Mouse sgRNA library Brie in lentiCRISPRv2 (Doench et al., 2016) RRID: Addgene_73632 Plasmid lentiGuide-Puro (Sanjana et al., 2014) RRID: Addgene_52963 Plasmid lentiGuide-Cherry This paper RRID: Addgene_170510 Plasmid Mouse sgRNA library Brie in lentiGuide-Cherry (Cherry Brie Library) This paper RRID: Addgene_170511 Plasmid pMD2.G A gift from Didier Trono RRID: Addgene_12259 Plasmid pHIT123 (Soneoka et al., 1995) N/A Plasmid psPAX2 A gift from Didier Trono RRID: Addgene_12260 Software and algorithms MAGeCK (Li et al., 2014) N/A STRING analysis (Szklarczyk et al., 2019) RRID: SCR_005223 Cutadapt (version 1.9.1) (Martin, 2011) RRID: SCR_011841 RSEM package (version 1.3.0) (Li and Dewey, 2011) RRID: SCR_013027 STAR alignment algorithm (version 2.5.2a) (Dobin et al., 2013) RRID: SCR_004463 Ensembl genome browser (assembly GRCm38, release 89) (Kersey et al., 2016) RRID: SCR_013367 DESeq2 package (version 1.12.3) (Love et al., 2014)l RRID: SCR_015687 R (version 3.3.1) (R Core team, 2015) N/A MATLAB Mathworks RRID: SCR_001622 Fiji-ImageJ (Schindelin et al., 2012) RRID: SCR_002285 (Continued on next page) Immunity 54, 2756–2771.e1–e10, December 14, 2021 e6 .. REAGENT or RESOURCE SOURCE IDENTIFIER FlowjoTM Software for Mac OS X (Version 10.7.1) BD RRID: SCR_008520 Graphpad Prism (Version 8.4.3) Graphpad Software LLC RRID: SCR_002798

    Article Title: Genome-wide pooled CRISPR screening in neurospheres.
    Article Snippet: Spheroid culture systems have allowed in vitro propagation of cells unable to grow in canonical cell culturing conditions, and may capture cellular contexts that model tumor growth better than current model systems.. The insights gleaned from genome-wide clustered regularly interspaced short palindromic repeat (CRISPR) screening of thousands of cancer cell lines grown in conventional culture conditions illustrate the value of such CRISPR pooled screens.. It is clear that similar genomewide CRISPR screens of three-dimensional spheroid cultures will be important for future biological discovery.

    Genome Wide:

    Article Title: Genome-wide pooled CRISPR screening in neurospheres.
    Article Snippet: Spheroid culture systems have allowed in vitro propagation of cells unable to grow in canonical cell culturing conditions, and may capture cellular contexts that model tumor growth better than current model systems.. The insights gleaned from genome-wide clustered regularly interspaced short palindromic repeat (CRISPR) screening of thousands of cancer cell lines grown in conventional culture conditions illustrate the value of such CRISPR pooled screens.. It is clear that similar genomewide CRISPR screens of three-dimensional spheroid cultures will be important for future biological discovery.



    Similar Products

    90
    Addgene inc brie lenticrisprv2 mouse genome-wide library
    Brie Lenticrisprv2 Mouse Genome Wide Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/brie+in+lenticrisprv2/lenticrisprv2/pm37286821-127-4-17
    Average 90 stars, based on 1 article reviews
    brie lenticrisprv2 mouse genome-wide library - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    94
    Addgene inc paper n a recombinant dna plasmid mouse sgrna library brie in lenticrisprv2
    Paper N A Recombinant Dna Plasmid Mouse Sgrna Library Brie In Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/brie+in+lenticrisprv2/Mouse+CRISPR+Knockout+Pooled+Library+(Brie)+(Pooled+Library+%2373632%2C+%2373633%2C+%2373633-LV)/pm34879220-249-59-75
    Average 94 stars, based on 1 article reviews
    paper n a recombinant dna plasmid mouse sgrna library brie in lenticrisprv2 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Addgene inc mouse sgrna library brie in lenticrisprv2
    KEY RESOURCES TABLE
    Mouse Sgrna Library Brie In Lenticrisprv2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/brie+in+lenticrisprv2/Mouse+CRISPR+Knockout+Pooled+Library+(Brie)+(Pooled+Library+%2373632%2C+%2373633%2C+%2373633-LV)/pmc07686957-54-0-12
    Average 94 stars, based on 1 article reviews
    mouse sgrna library brie in lenticrisprv2 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    Addgene inc lenticrisprv2-brie library
    KEY RESOURCES TABLE
    Lenticrisprv2 Brie Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/brie+in+lenticrisprv2/lenticrispr+v2/pmc07341821__mmc7-401-153-156
    Average 90 stars, based on 1 article reviews
    lenticrisprv2-brie library - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    94
    Addgene inc mouse crispr sgrna library lenticrisprv2 brie

    Mouse Crispr Sgrna Library Lenticrisprv2 Brie, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/brie+in+lenticrisprv2/Mouse+CRISPR+Knockout+Pooled+Library+(Brie)+(Pooled+Library+%2373632%2C+%2373633%2C+%2373633-LV)/pmc07341821-349-16-21
    Average 94 stars, based on 1 article reviews
    mouse crispr sgrna library lenticrisprv2 brie - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    96
    Addgene inc lenticrisprv2 brie library

    Lenticrisprv2 Brie Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/brie+in+lenticrisprv2/lentiCRISPRv2+blast+(Plasmid+%2398293)/pmc07341821-36-0-3
    Average 96 stars, based on 1 article reviews
    lenticrisprv2 brie library - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    94
    Addgene inc mouse crispr knockout library lenticrisprv2 brie

    Mouse Crispr Knockout Library Lenticrisprv2 Brie, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/brie+in+lenticrisprv2/Mouse+CRISPR+Knockout+Pooled+Library+(Brie)+(Pooled+Library+%2373632%2C+%2373633%2C+%2373633-LV)/bio_rxiv__2020__02__26__964981-195-16-21
    Average 94 stars, based on 1 article reviews
    mouse crispr knockout library lenticrisprv2 brie - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    96
    Addgene inc lenticrisprv2 brie library addgene

    Lenticrisprv2 Brie Library Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/brie+in+lenticrisprv2/pCL-Eco+(Plasmid+%2312371)/loo_chin_san__2020__a_genome_wide_crispr_screen_reveals_a_role_for_the_non_canonical_nucleosome_remodeling_baf_complex_in_foxp3-299-17-19
    Average 96 stars, based on 1 article reviews
    lenticrisprv2 brie library addgene - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: TFEB Transcriptional Responses Reveal Negative Feedback by BHLHE40 and BHLHE41

    doi: 10.1016/j.celrep.2020.108371

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Mouse sgRNA library Brie in lentiCRISPRv2 , Doench et al., 2016 , Addgene #73632.

    Techniques: Binding Assay, Virus, Recombinant, Electron Microscopy, Staining, cDNA Synthesis, SYBR Green Assay, Software, Imaging

    Journal: Immunity

    Article Title: A Genome-wide CRISPR Screen Reveals a Role for the Non-canonical Nucleosome-Remodeling BAF Complex in Foxp3 Expression and Regulatory T Cell Function

    doi: 10.1016/j.immuni.2020.06.011

    Figure Lengend Snippet:

    Article Snippet: To create a pooled sgRNA library in pSIRG-NGFR, we first amplified sgRNA sequences from an optimized mouse CRISPR sgRNA library lentiCRISPRv2-Brie (Addgene #73632).

    Techniques: Recombinant, Transfection, Software

    Journal: Immunity

    Article Title: A Genome-wide CRISPR Screen Reveals a Role for the Non-canonical Nucleosome-Remodeling BAF Complex in Foxp3 Expression and Regulatory T Cell Function

    doi: 10.1016/j.immuni.2020.06.011

    Figure Lengend Snippet:

    Article Snippet: lentiCRISPRv2-Brie library , Addgene , Cat#73632.

    Techniques: Recombinant, Transfection, Software